Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_0002198/hsa_circ_0002198 | |||
Gene | PDE7B | Organism | Human |
Genome Locus | chr6:136472297-136476896:+ | Build | hg19 |
Disease | Ovarian Endometriosis | ICD-10 | Endometriosis of ovary (N80.1) |
DBLink | Link to database | PMID | 29483390 |
Experimental Method | |||
Sample Type | Endometrial Tissues | Comparison | 63 clinical samples, including control endometrium (n = 22) and eutopic endometrium (n = 41) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GCAAACCTATATCAGGAAACAGC ReverseTTGAAGAGGTGGCACAACAGT | Statistics | Fold Change : Upregulated,4.63 pvalue : p<0.05 |
Citation | |||
Xu, XX, Jia, SZ, Dai, Y, Zhang, JJ, Li, XY, Shi, JH, Leng, JH, Lang, JH (2018). Identification of Circular RNAs as a Novel Biomarker for Ovarian Endometriosis. Chin. Med. J., 131, 5:559-566. |